antisense oligonucleotides Search Results


mmp 7 antisense oligonucleotide  (Santa Cruz Biotechnology)
90
Santa Cruz Biotechnology mmp 7 antisense oligonucleotide
Mmp 7 Antisense Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/us11369638-341-94-143?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
mmp 7 antisense oligonucleotide - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotides  (Integrated DNA Technologies)
94
Integrated DNA Technologies antisense oligonucleotides
Antisense Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/10__1158_slash_1078___0432__ccr___12___0792-77-4-9?v=Integrated+DNA+Technologies
Average 94 stars, based on 1 article reviews
antisense oligonucleotides - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
antisense oligonucleotide  (Santa Cruz Biotechnology)
86
Santa Cruz Biotechnology antisense oligonucleotide
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pm12507930-115-9-21?v=Santa+Cruz+Biotechnology
Average 86 stars, based on 1 article reviews
antisense oligonucleotide - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier
20-mer p21 antisense oligonucleotide (tccccagccggttctgacat)  (GeneWorks)
90
GeneWorks 20-mer p21 antisense oligonucleotide (tccccagccggttctgacat)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
20 Mer P21 Antisense Oligonucleotide (Tccccagccggttctgacat), supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/10__1074_slash_jbc__m004424200-88-19-31?v=GeneWorks
Average 90 stars, based on 1 article reviews
20-mer p21 antisense oligonucleotide (tccccagccggttctgacat) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc)  (MWG-Biotech ag)
90
MWG-Biotech ag 0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
0.1–1.0 μm Of Antisense Gene Specific Oligonucleotide Primer (Mwgbiotech, High Point, Nc), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pmc02576272-315-20-24?v=MWG-Biotech+ag
Average 90 stars, based on 1 article reviews
0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotide  (Hisamitsu Pharmaceutical Co Inc)
90
Hisamitsu Pharmaceutical Co Inc antisense oligonucleotide
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide, supplied by Hisamitsu Pharmaceutical Co Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/us08114884-52-9-3?v=Hisamitsu+Pharmaceutical+Co+Inc
Average 90 stars, based on 1 article reviews
antisense oligonucleotide - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotide targeted to ache mrna  (CH Instruments)
90
CH Instruments antisense oligonucleotide targeted to ache mrna
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide Targeted To Ache Mrna, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/us06987211-912-43-45?v=CH+Instruments
Average 90 stars, based on 1 article reviews
antisense oligonucleotide targeted to ache mrna - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
phosphorodiamidate morpholino oligonucleotides (pmos)  (Antisense Therapeutics)
90
Antisense Therapeutics phosphorodiamidate morpholino oligonucleotides (pmos)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Phosphorodiamidate Morpholino Oligonucleotides (Pmos), supplied by Antisense Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pm19004840-41-25-13?v=Antisense+Therapeutics
Average 90 stars, based on 1 article reviews
phosphorodiamidate morpholino oligonucleotides (pmos) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotides (mir inhibitors)  (Shanghai GeneCore BioTechnologies Co Ltd)
90
Shanghai GeneCore BioTechnologies Co Ltd antisense oligonucleotides (mir inhibitors)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotides (Mir Inhibitors), supplied by Shanghai GeneCore BioTechnologies Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pmc04558514-170-7-14?v=Shanghai+GeneCore+BioTechnologies+Co+Ltd
Average 90 stars, based on 1 article reviews
antisense oligonucleotides (mir inhibitors) - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotide inhibitors with nucleoside sugar modifications (2′ o methoxyethyl), with phosphodiester (po), phosphorothioate, and mixed ps/po backbones  (Regulus Therapeutics)
90
Regulus Therapeutics antisense oligonucleotide inhibitors with nucleoside sugar modifications (2′ o methoxyethyl), with phosphodiester (po), phosphorothioate, and mixed ps/po backbones
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide Inhibitors With Nucleoside Sugar Modifications (2′ O Methoxyethyl), With Phosphodiester (Po), Phosphorothioate, And Mixed Ps/Po Backbones, supplied by Regulus Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pmc04772951-224-11-22?v=Regulus+Therapeutics
Average 90 stars, based on 1 article reviews
antisense oligonucleotide inhibitors with nucleoside sugar modifications (2′ o methoxyethyl), with phosphodiester (po), phosphorothioate, and mixed ps/po backbones - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
mir-147 mimic  (Ribobio co)
90
Ribobio co mir-147 mimic
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Mir 147 Mimic, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pmc04727187-162-0-14?v=Ribobio+co
Average 90 stars, based on 1 article reviews
mir-147 mimic - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
antisense oligonucleotides targeting linc01852  (Ribobio co)
90
Ribobio co antisense oligonucleotides targeting linc01852
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotides Targeting Linc01852, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/pm38263157-51-12-17?v=Ribobio+co
Average 90 stars, based on 1 article reviews
antisense oligonucleotides targeting linc01852 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 11. Effect of two different antisense oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 11. Effect of two different antisense oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques:

Fig. 12. Down-regulation of NF-κB (p65) protein level in HCT-116RC cells by an antisense oligonucleotide. (A, B) Confocal images of cells stained with an antibody to p65 protein (red). Treatment with an antisense oligonucleotide (A) shows a decrease in p65 protein levels when compared with untreated control (B). Green fluorescence (C) indicates uptake of the p65 antisense oligonucleotides. (D) Immunocontrol for panels A and B, in which the primary antibody was omitted; minimal background fluorescence is shown.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 12. Down-regulation of NF-κB (p65) protein level in HCT-116RC cells by an antisense oligonucleotide. (A, B) Confocal images of cells stained with an antibody to p65 protein (red). Treatment with an antisense oligonucleotide (A) shows a decrease in p65 protein levels when compared with untreated control (B). Green fluorescence (C) indicates uptake of the p65 antisense oligonucleotides. (D) Immunocontrol for panels A and B, in which the primary antibody was omitted; minimal background fluorescence is shown.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques: Staining, Control

Fig. 13. Effects of missense and antisense p65 oligonucleotides (probe #9) on DOC-induced apoptosis of cells of resistant cell line HCT-116RC. The secondary structure of the missense probe was designed to match that of the antisense probe #9.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 13. Effects of missense and antisense p65 oligonucleotides (probe #9) on DOC-induced apoptosis of cells of resistant cell line HCT-116RC. The secondary structure of the missense probe was designed to match that of the antisense probe #9.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques: